Taglines

 !!!teG I sdrawkcaB eroM ehT oG I sdrawroF eroM ehT

!(a+b) = !a * !b =0

"2nd star on the right, then on until morning"

"640K ought to be enough for anybody." - Bill Gate

"Admiral, there be whales here!"  ...  "Scotty, that's a \SLMR\TA

"Apple I" (c) Copyright 1767, Sir Isaac Newton.

"Beautiful story.  Kinda gets you right HERE!"  -- Q

"Besides, it is clearly a bunny rabbit!" -- Data

"Captain, Permission to hook up blender attachments to Mr\SLMR\TA

"Could you continue your petty bickering? I find it most \SLMR\TAGLIN

"Damage control is easy. Reading Klingon -- that's hard."\SLMR\TAG

"Dammit, Jim!  I'm a doctor, not a physician!"  -- McCoy

"Damnit Jim, I'm a doctor not a Tagline..."

"Data does it in serial..."  --Tasha Yar

"Data, I thought you were dead!" "No, sir, I rebooted.."

"Do you know any Klingon opera?"  - Worf

"Don't dispute death unless you've lived through it."  --\SLMR

"Drop the guy with the devil ears." -- NBC, June, 1965.

"Extra pickles.  A warrior's condiment!"  --Worf

"Extra pickles. A warriors condiment." -Worf

"Fire, Mr. Worf!"  <Worf picks up extinguisher>

"Flowers!  Is there a 'John Luck Pikkerd' here?"  --Q

"For there is no sea, with out the dolphin" -- Oppian

"He was a man, all and all, I shall not look upon his lik\SLMR\TAG

"He's a potato Jim!, Let's gouge out all of his eyes"

"Hey, Worf...I hooked Data up to a Modem...Wanna see?"

"I am programmed in multiple pleasuring techniques."  --D\SL

"I am what I am and that's all that I am" 

"I did it. I killed them all." Timothy

"I don't bite. Well, that's wrong. I do bite."  -K'Ehleyr

"I hate questionarres"-Worf

"I like my species the way it is." - Worf to Locutus

"I never lie when I have sand in my boots!" -- LaForge

"I think not," said Descartes; and promptly disappeared.

"I'm Beverly...","I'm Geordi...","We are Hugh..."

"I'm not the one that misplaced the Deltivid asteroid bel\

"If you prick me, do I not...  Leak?" -- Data

"Is that funny?  Is that a joke?"  --Data

"Is that lemon in your tea?"  "No, s'lime."

"It's comin' apart, Lad!" - Scotty

"Listen, have you seen the dolphins yet?" -Geordi

"Look at all the Indians!" - General Custer

"Modem," said the gardener when he'd finished the lawn..

"Mr. Worf, fire phasers at @FN@" ... Zzzzzap!

"Mr. Worf, fire!"  <Worf picks up extinguisher>

"My favorite part of dinner!"- Riker

"RESISTENCE IS FUTILE...." The Borg

"Scotty!  Beam me aboard!"  "Aye sir!  Will a 2x4 do?"

"Scotty, I've fallen and I can't beam up!"

"Scotty, beam me up another Blue Wave message."

"Scotty, beam us a board!" (2x4 drops from sky)

"Sex is better than reading; no overdue fines."  --Jean-L\SLMR\TAG

"Sir! Klingons on the starboard bow!" "Well, scrape 'em o\SL

"Such grudges.  Give us a kiss, Worf." - Q

"Take my Worf... please."  --Data

"That was the stun setting." <bleep> "This is not."

"That's no tagline!  It's Odo!"

"The Dolphin, ne'er has anything been more divine"-Oppian

"The above Statement is absolutely True." --God

"The security of the Enterprise is of Paramount importanc\

"They are not the hell your whales." - Spock

"We must laugh at man, to avoid crying for him" Napoleon

"Worf!  Still struggling up the evolutionary ladder?" - Q

$1000 reward for finding this man:

'Ah!  I have access.' --Data

'Only a vaRool would use such language in public.' --Rike

'Perhaps you and the jerko here could come with us.' --Lw

'Saddle up, father!' --Alexander, to Worf

'The universe is a spheroid region 705 meters in diameter\SLMR\TAGLIN

'Transporting really is the safest way to travel.' --Geor\S

(((((((HYPNOTIC)))))))(((((((TAGLINE)))))))

(A)bort, (R)etry, or (I)nfluence with hammer.

(C)ontrol (A)lt (B)ye

(Ice rocks hit the hull)  "Captain, we are being hailed."

(beep) Help, I've fallen and can't reach the beer.

* <-- Tribble   o <-- Jean Luc Tribble

* <-Tribble  ù <-Tribble after a close shave

* <-Tribble  ù <-Tribble after a close shave.

* This is a tribble.  # This is a tribble on drugs.

*/  <==-- Tribble with a lightsaber

--------------------- cut here --------------------------

----> If you cut here, you'll ruin your monitor. <----

--T-A+G-L-I+N-E--+M-E-A+S-U-R+I-N-G+--G-A+U-G-E--

... Scotty!, Hurry beam me u%#$&      NO CARRIER

... and eliminate and wipe out redundancy!

...and my special thanks to the Other Forty-Nine!

...and then I woke up!

...but what I really want to do is direct.

11th commandment - Covet not thy neighbor's 586.

15› of every stamp is for storage

186,000 miles/sec: Not just a good idea, it's the LAW.

1st we shoot all the lawyers, 2nd we strangle them, 3rd..

24 hours in a day and 24 beers in a case.  Hmmmm.....

2400 Baud makes you want to get out and push!!

320

33mHz ain't fast enough!

4 food groups: fast, frozen, microwaved, and junk

4 food groups: fast, frozen, microwaved, and junk.

43% of all statistics are worthless.

9600bps and under are insults to HST'ers -Hacker's law #5

:.::: ::..: ::.::.  :..:: Tagline in Braille

<%>{ 1 fish, <%>{ 2 fish, <%>{ red fish, <%>{ blue fish

<<---- THIS SPACE FOR SALE ---->>

<ZAP!> That was *not* manual override.  -- Data

>> BEER.CAN not found, USER.EXE not loaded <<

A 100% right of return both ways.

A BBSer's telephone bill knows no bounds...

A Thousand points of Broccoli!

A bird in the hand is safer than one overhead.

A cats worst enemy is a closed door.

A clean desk is a sign of a -sick- mind

A clean desk is a sign of a cluttered desk drawer.

A clean disk is the sign of a warped drive.

A clean, neat, desk is a sign of a very sick mind.

A closed mouth gathers no feet...

A committee has 6 or more legs and no brain.

A friend: someone who likes you even after they know you.

A lie that can be passed off as truth becomes truth.

A little nukie never hurt anyone!

A phaser is the universal communicator. þ Worf

A phaser on stun is like a day without orange juice.

A piano is a piano is a piano. Gertrude Steinway.

A seminar on Time Travel will be held two weeks ago

A single fact can spoil a good argument.

A stitch in time would have confused Einstein.

A thick head can do as much damage as a hard heart.

A tribble a day keeps the Klingons away.........

A wise man once said.... I don't know...

A wok is what you throw at a wabbit.

A)bort R)etry G)et a stick and kill it.

AAAAA - American Association Against Acronym Abuse

ASCII and ye shall receive.

ASCII stupid question... get a stupid ANSI!

After we pull the pin, Mr. Grenade is NOT our friend!

Ah, come on, just this one last little feature.

Ah, my trombone.  Let me show you how it works. þ Riker

Air Geordis - TNG footwear

Alex, I'll take "Things Only I Know" for $1000.

All I need to know I learned from my cat.

All babies speak Klingonese

All hope abandon, ye who enjoy tax forms.

All hope abandon, ye who enter messages here.

All programers are optimists.

Always proofread carefully to see if you any words out.

An ulcer is what you get mountain climbing over molehills

Ancient Greeks made dolphin-killing punishable by death.

And God said, "I'll buy a vowel."

Another nearly-full box of Smarties!!

Anything not nailed down is a cat toy...

Are they made from real Girl Scouts?

Are those cookies made with real Girl Scouts?

Are you prepared to defend yourself?

Artificial Intelligence is no match for natural stupidity

As I said before, I never repeat myself.

As easy as 3.14159265358979323846264338327950288419716

As long as I can remember, I've had amnesia.

Assumption is the mother of all screwups...

BASIC isn't; C stands for Confusing...

BBS: a method to triple your phone bill.

BREAKFAST.COM Halted... Cereal Port Not Responding.

Back Up My Hard Drive? I Can't Find The Reverse Switch!

Back Up My Hard Drive? I don't have a license yet!

Bad command or file name!  Go stand in the corner.

Barney and Baby Bop MUST DIE!

Be Nice to Your Enemies, It Drives Them Nuts.

Be excellent to each other..

Beam me aboard Scotty.  Aye, will a 2x4 do captain?

Beam me up, Scotty, This planet sucks!

Beam me up, Scotty, but leave the others here.

Beat me, whip me, make me read my Qmail!

Beauty is in the eye of the beer holder....

Beep! Invalid Input.  I take only cash....

Behaviorism is the art of pulling habits out

Behind every succesfull man is woman with nothing to wear

Best file compressor around: DEL *.* (100% compression)

Beware of Geeks bearing gifs.

Beware of programmers who carry screwdrivers.

Beware of quantum ducks.       Quark!     Quark!

Big things come in .QWK packages.

Biography: One of the terrors of death.

Blessed are the Greeks

Blessed our young they will inherit our national debt.

Boldly going Forward because we can't find Reverse!

Boldly going where no modem has gone before...

Borg Empire: Equal opportunity Assimilator!!!!

Borg saying: We came. We absorbed. We left.

Borg spreadsheet program:  Locutus 1-2-3

Borg spreadsheet: Locutus 1-2-3

Borg?  Where?  I don't se*(#$#..NO CARRIER

BorgBurgers - We do it our way; your way is irrelevant.

BorgBurgers: We do it OUR way. Yours is irrelevant

BorgDOS v5.0  - Assimilate Another? [Y/n]

Borger King - We do it our way! Your way is irrelevant!

Both of his feet are firmly planted in the air.

Brain: apparatus used to think we think.

Break up a relationship - buy a computer!!

C program run, C program crash, C programmer cry.

CA bumper sticker: Cover me, I'm changing lanes.

CONgress (n) - Opposite of PROgress

CPAV Warning:(S)top (C)ontinue (B)urn infected disk

CPU - Random number generator

Can you do the Picard Maneuver in a Grand Am?

Can't learn to do it well? Learn to enjoy doing it badly

Can't learn to do it well? Learn to enjoy doing it badly!

Captain, I protest.  I am NOT a merry man! - Worf

Captain, phasers and photons down, get the hand phaser ou\

Captain, the UARTs won't take this Speed!

Cavorting about like that isn't proper behavior. þ Picard

Censorship is something ÛÛÛÛÛÛ ÛÛÛÛ I do ÛÛÛ like!

Cereal Killer Strikes Again! Cap'n Crunch found dead...

Children: Pure love contained in soft packages.

Circular Definition: see Definition, Circular.

Claravoiant meeting canceled due to unforseen events.

Clones are people two.

Closing on ship target.  Music on!  Fire away!

Cold pizza:  the generic breakfast

Coming Soon. Mouse Support for Turbo Edlin!

Complaints? Write them here legibly [] <-

Computer Lie #1: You'll never use all that disk space.

Computers are OUR business, our ONLY business

Computers are not intelligent. They only think they are

Computers can never replace human stupidity.

Congratulations Data, it's a girl.  Troy - The Offsprin

Constant change is here to stay.

Constipated Pakleds:  "We look for things, things to make\SLMR\TAGLI

Consult a real expert - Call your mother!

Contentsoftaglinemaysettleduringshipping.

Copywight 1991 Elmer Fudd.  All wights wesewved

Crewman Green, step on that rock!  <BOOM>

Crusher: Worf, have you seen Wesley?   Worf: No, I haven'\

Crusher: Worf, have you seen Wesley? ... Worf: No, I have\SLMR\TAGLIN

Cut my pizza in six slices, please; I can't eat eight.

DO NOT REMOVE THIS TAG (UNDER PENALTY OF LAW)

DOS + Windows + ATM < OS/2 2.0

DOS Tip : Don't use DOS.

DOS is just an operating system that runs Windows 3.1

DOS means never having to live hand-to-mouse

Daddy, what does FORMATTING DRIVE C: mean?

Daddy, what does RESET mea

Dammit Bones, I'm a captain, not a doctor!

Dammit Jim, I'm a doctor, not a tagline writer.

Damn it Jim, I'm a doctor not a doctor! Hey, wait a minut\S

Damn this hobby is expensive!

Damn! Outta Antimatter. I told Geordi $50 wasn't enough

Darmok and Jhilad at Tanagra

Data, data everywhere, and not a byte to eat!

Dead, huh?  Well, that's one less thing. þ Beverly

Deadwood. Nineteenth Century Earth. The Ancient West.

Death is proven to be 99.9% fatal to all laboratory rats.

Deep Space Nine:  The Third Coming of Star Trek!

Definition of Terror: A female Klingon with PMS.

Dessert? I'll take a piece of cherry ã.

Detach the saucer, Data.  Don't spill the tea!

Did you know that no-one ever reads these things?

Discoveries are made by not following instructions.

Divers do it better under pressure.

Divers do it deeper.

Do Androids Dream of Electric Sheep?  Ask Data.

Do Not Attempt to Traverse a Chasm in Two Leaps...

Do not believe in miracles -- rely on them.

Do unto others JUST BEFORE they do unto you!

Does Windows 3.1 come with a Hard Drive?

Does anybody have a ";" Reminder key?

Does history record any case where a majority was right?

Doing my part to preserve order in the universe

Don't drink and park, accidents cause people

Don't take life so seriously.  It won't last.

Don't use a big word where a diminutive one will suffice.

Don't worry, I'm fluent in weirdo...

Dr. McCoy, I hate your #*@%ing human guts.  Discussion?

Dr. Soong did not intend me to be used this way. þ Data

Drive C: Error, (A)bort (R)etry (I)gnore (K)ick (S)cream

Duh. . . I didn't know FORMAT C: did that!?

Dumb luck beats sound planning every time.  Trust me.

ERROR: Unable to come up with a good tagline.

Eagles Soar!, but weasels arn't sucked into jets!

Earthquakes are Earth's way of saying, WAKE UP !!!!!!!!!!

Eat any good books lately þ Q

Efficiency takes time!  Frugality: who can afford it?

Ensign Pillsbury:  He's bread Jim!

Error - [A]bort, [R]etry, [F]ake like it's working...

Error 216: Tagline out of paper

Eschew obfuscation!

Ever stop to think, and forget to start again?

Every little BYTE helps

Every man's work is a portrait of himself.

Everybody remember where we parked.  -- Kirk

Everything that is not mandatory is forbidden.

Evil Grin #13  <<<<<GRIN>>>>>

Evolution is RELIGIOUS because it can't be proven!

Exam is a four-letter word for torture...

Excuse me, do you mind if I squish in here?  - Odo

Experience is a good teacher but her fees are high

Experience: What you get when you don't get what you want

FILE NOT FOUND..... Should I fake it? [Y/n].........

Fax me no questions, I'll Fax you no lies!

Feed your faith and starve your doubts to death.

Feet Smell?  Nose Run?  Hey, you're upside down!

Fiddle: Friction of a horse's tail on a cat's entrails.

Fine, Fine...Have your Klingon servent get some chairs!

Fire at Will!  >ZAP<  THANK you Data...I mean, 'Number On\SLMR\TAGLIN

For at the end of history lies the undiscovered country.

For discussion only. Not to be relied upon.

Format all 10?  Only 3 fit in the slot.

Fraud(n): A telephone number starting with "1-900"

Freedom of religion is also freedom FROM religion. . .

From the creative workshops of Soong, Inc.

G=Guns, PG=Plenty of Guns, PG-13=More than 12 guns...

Geneology: chasing your own tale.

Get off my kitchen floor...will ya!

Get your grubby hands off my tagline! I stole it first!

Ghosts are merely unsubstantiated roomers.

God has always been hard on the poor.

Going tagless has been a freeing experience!

Going to fly?  Walk, you'll get there faster!

Good day for flying but bad day for landings....

Got arrested for going 14400 in a 2400 zone.

Ground yourself, THEN hug your motherboard!

Growing old is mandatory; growing up is optional!!

Guess who's coming to dinner.  -- Chekov

Guinan's secret power:  her hat is a solar panel.

Happiness is a twit filter...

Happiness is finding special characters 

Happiness is your favorite program moving to Windows.

Hard work never killed anyone but why take a risk?

Have the boy sent to the bridge. - Picard

He that hath ears to hear, let him hear.

He who laughs, lasts.

He's alive, Jim.  Should I shoot him again?

He's dead Jim.  You get his tricorder,  I'll get his wall\S

He's dead Jim.  You take his phaser and I'll get his wall\SL

He's dead Jim... Grab his wallet!

He's got a magnet!!!  Everybody BACKUP!!!!!!!!

He's not dead, Jim, he's just metabolically challenged.

Hell with Pascal and C.  I am a QuickBasic Snob.

Hello, I am part number ³ºÞº³º³Û³ºÝ³ºÝ³³

Help!  I'm parked diagonally in a parallel universe.

Help, I'm modeming! And I can't hang up!

Her last birthday cake looked like a prairie fire!

Here Tag! C'mon Tag! Good Tag. Good boy!

Hey Odo, got any more of that Jell-O in the 'fridge? ...O\SLMR\TAGL

Hey!  Your Trakball is upside down!

Hi! I'm a tagline virus! Steal me & join in the fun!

Hire the morally handicapped

Hiya, Doc! What's cookin'? - Data

Hold on - wait, maybe the answer's looking for you.

Honor would be better served if I were your mate. þ Worf

Housework can kill you if done right.

How come all the buttons keep flying off my shirt?

How could I have downloaded a virus?!?!  It said NO CARRI

How do frogs die? Ker-mit suicide

How many of you believe in telekinesis?  Raise MY hand!

How much can I get away with and still go to heaven?

How'm I flyin'?  Dial 1-800-BORG-YOU. -Borg

How's this for diplomacy?  Shoot them all!  --Kirk

Human Intelligence. The greatest oxymoron ever!

Humans: The species that should have never been...

I AM RELAXED! - Worf

I BBS because no one can read my handwriting

I DO NOT...I do not yell.  -- Worf

I Had A Life Once, Now I Have A Computer

I Have To Stop Now, My Fingers Are Getting Hoarse!

I Just can not resist a little fun along the way.  :-)

I am Locutus of Borg.  Do you have any Grey Poupon?

I am Locutus of Borg. I demand Earl Grey tea - for 10000.

I am afraid that is beyond my design parameters. þ Data

I am. Therefore, I think.  I think.

I believe I will take this opportunity to remove my ears.

I call my computer "Hole in the Desk"

I came. I saw. I charged it.

I can SPELL, I just can't TYPE worth a hoot !

I can assure you that size will not be a problem. þ Worf

I can't be overdrawn, I still have more checks!

I can't believe my computer's on fire.

I can't, Doctor. I might hurt you. þ Worf

I could be arguing in my spare time.

I didn't know it was impossible when I did it.

I do know a few things about anatomy, Jean-Luc. þ Beverly

I don't know much about panda bears, Number One. þ Picard

I don't steal taglines -- I replicate them.

I don't want to think.  I just want to be...

I fear you must blame your own perverse urges. þ Picard

I feel fine.....Everything seems a little smaller. - Pica\S

I find push buttons very depressing......

I got it all together, then forgot where I put it.

I had a handle on life, but it broke.

I had a life once... Now I have a computer.

I hate making predictions; especially about the future!

I have a mind like a steel...uh...thingamajig...

I have a speech impediment....my foot!!!

I have something BETTER than chocolate. þ Riker

I idiot-proof my programs,but along comes a bigger idiot.

I just play here.

I just steal 'em, I don't explain 'em.

I just steal them, I don't write them.

I know so little, but I know it fluently...

I like Boolean logic. NOT!

I love my computer. It's made in Taiwa~##$ ` #@

I may not always be perfect, but I'm always me.

I only counted 100 dalmatians...!!!

I prefer the company of equals. - Riker

I remember the words. I don't understand.

I remember when Saturns were rockets, not cars.

I sense... *SLAP*  Not while we're on the bridge, Will!

I still miss my ex-wife - but my aim is improving!

I tell them there's no problems...Only Solutions...

I thought DEL *.* -really- deleted the files!

I took thee for thy better.  Take thy fortune.

I used to be indecisive.  Now I'm not sure.

I used to have a handle on life, then DOS closed it...

I used to watch TV, then I bought a modem.

I want everything; do you have it??

I was going to procrastinate, but I put it off....

I was just stopped by the LAPD and boy am I beat !

I wasn't always like this, Lieutenant. þ Picard

I wish I had a snappy Trek Tagline to put here...

I wish life had a scroll-back buffer.....

I would ask that you stop fiddling with my ears. þ Data

I wouldn't touch the Metric System with a 3.048m pole!

I wrote my own benchmark, my machine is now 500MHz

I'd like to live like a poor person with lots of money.

I'd really like to lay one across your teeth. þ Beverly

I'll have one brain on drugs with bacon, toast and juice.

I'll have what the guy on the floor is having...

I'll jump off that bridge when I come to it.

I'll see you in hell before I'd do that. þ Ro

I'm SO confused...

I'm an absolute, off-the-wall fanatical moderate.

I'm at the corner of Walk and Don't Walk.

I'm bloody sick of standing here every day. þ O'Brien

I'm dangerous when I know what I'm doing.

I'm fascinated by the way memory diffuses fact.

I'm in shape ... Rounds a shape isn't it?

I'm leaving my body to science fiction.

I'm losin' it! - Geordi

I'm no stranger, just a friend you haven't met...

I'm not a complete idiotÄÄseveral parts are missing.

I'm not dead. I'm electroencephelographically challenged.

I'm not dead; I'm "metabolically challenged."

I'm not just one of your snuggle-girls, Will. þ Beverly

I'm not lost!  I'm "locationally challenged."

I'm not nearly as think as you confused I am.

I'm not schizophrenic.  It's this guy beside me!

I'm on the corner of Walk and Don't Walk

I'm on the corner of Walk and Don't Walk!

I'm out of bed and dressed.  What more do you want?

I'm saving my money for when they get Phaser Printers!

I'm sorry, this tagline is not an apology!

I'm spending a year dead for Tax Purposes

I'm sure it's in the manual somewhere...

I'm the person your mother warned you about...

I'm too skeptical to deny the possibility of anything...

I'm writing a book. I've got the page numbers done.

I've fallen...but I'll be back...Arnold Schwarzeneg

I've got 256K of RAM, so why can't I run Windows 3.0?

I've got a mind like a... a... what's that thing called?

I've used Basic so long, my brain has gonesub permanently

I@love~my$computer,;It's%made in Taiwa~##$ ` #@

If At First You Don't Succeed Ignore The Docs

If At First You Don't Succeed Ignore The Docs...

If Data is "fully functional," can he get a woman pregnan\S

If I save the whales, where do I keep them?

If I save time, when do I get it back ?

If I want your opinion I'll beat it from you

If I were you, who'd be me?

If Q was female, would he be called O?

If Q were castrated would he become ... O ???

If Q were castrated, would he become O?

If anything -can't- go wrong, it will

If at first you don't succeed, call it Ver 1.0

If at first you don't succeed, try skydiving ...

If humans have orgasms, do the Borg have Borgasms?

If it ain't broke, break it and charge for repair.

If it works, rip it apart and find out why!

If it's not broke, let me take a crack at it.

If it's stupid, but it works, then it's not stupid.

If only Einstein had a 486DX-33....   like I do...

If plugging it in doesn't help, turn it on.

If rabbits feet are so lucky, what happened to the rabbit

If rabbits feet are so lucky,what happened to the rabbit

If speed scares you, try Micro$oft Windows.

If speed scares you, try Windows...

If the shoe fits, put it in your mouth.

If there was a nuclear bombing, would I be alive to care?

If there was a wait for Q to show up, would there be a Q \SLMR\

If there's one thing I can't stand, it's intolerance.

If this were an actual tagline, it would be funny.

If we left the bones out it wouldn't be crunchy.

If winning isn't important then why keep score?

If you can read this, you're irrelevant. -Borg

If you can't beat em', mod em'.

If you need a calculator, its too complex.

If your ship doesn't come in, swim out to it!

Ifyoucanreadthis,youspendtoomuchtimefiguringouttaglines.

Illiterate?  Write for a free brochure!

Immorality will continue until beatings improve.

In case of fire, yell "FIRE!"

In it's former life, my computer was a Cray...

Indeed, Captain Picard, you have found him. þ Spock

Insanity is just a state of mind.

Insanity runs in my family; it practically gallops...

Insert disk with \HURTME.COM and strike Worf when ready.

Intriguing. I did not know humans were so capable. þ Data

Is it still paranoia if they ARE ALL out to get me?

Is it still paranoia if they ARE ALL out to get me???

Is this yours?  Your dog left it on my lawn...

Is this yours? Your dog left it on my lawn ...

It can't be full...I STILL HAVE SUBDIRECTORIES !

It depends on which end he tries to light...

It doesn't work, but it looks pretty.

It has many other uses as well.  Allow me. þ Worf

It is better to be brief than boring.

It is fatal to live too long.

It is, after all,  only a moment in the infinity of time.

It said "insert disk #3" - but onty two will fit...

It works better when you turn the brightness up.

It's a fine line between fishing & standing still

It's d‚j… vu all over again.

It's not GEEK - it's SOCIALLY CHALLENGED, dammit!

It's not a person, damnit! It's a Borg!

It's not easy having an overbearing parent! - Troi

It's not in the manual !!!!!

It's not the money I want, it's the stuff.

It's only a hobby ... only a hobby ... only a

It's raining, it's pouring, the old man is...dead, Jim.

It's worse than that, it's physics, Jim!

Jesus saves...Passes to Moses..Shoots....Scores!

Join the Group Mind - become a Borg

Joseph Stalin's grave was a Communist Plot.

Junk: stuff we throw away.  Stuff: junk we keep.

Just another inmate in this ASYLUM!!!

Just cannot resist a little fun along the way.  :-)

Just for today..... do not anger.

Just give me what the Dr.ordered..OHHOOO Dr Pepper..

KPLA, Klingon radio:  All glory, all the time!

Kids-They're not sleeping, they're recharging!

Kill them all!  .... Let God sort them out.

Kill'em All ... Let God Sort Them Out.

Klingon Thanksgiving Grace:  "Let us prey..."

LOTUS - Let Only The Users Suffer

Laddie, ya think ya might like ta ... rephrase that?

Last yur I kudnt spel modjerater now I are won.

Law of Insurance and Taxes - Whatever goes up, stays up.

Let's organize this thing and take all the fun out of it.

Lets all take the TIME to really LISTEN 2 r KIDS

Life - brief interlude between nothingness and etern

Life Facts..Death, Taxes, and "THEY" will Tax us to Death

Life can be great if you live it to the fullest!

Life is a banquet & most suckers are starving!

Like, I think my bottle absorbed my Beer, eh.

Liposuction will destroy your FAT

Little boats should keep near the shore.

Lore: Takes a licking and keeps on twitching.

MFM/RLL/SCSI/ESDI/IDE.... what's next

MS-DOS....DR DOS' Sister.

MacIntosh:Computer with training wheels you can't remove.

Madness takes its toll - please have exact change

Make Headlines..use a corduroy pillow....

Make me an offer. I have a computer to support!!

Make me an offer. I have a computer to support!!

Make me breakfast and perhaps I'll consider it. þ Troi

Man looks into the abyss, and sees himself.

Man who eats too many prunes, sits on toilet, many moons!

Marriage isn't a word, it's a sentence.

Mary had a little lamb.  The doctor was surprised.

Master of all I survey (at the moment, empty pizza boxes)

McBorg:  Over 50 million assimilated!

Meditation is not what you Think.

Meet the new Boss--same as the old Boss...

Member: International Brotherhood of Tagline Thieves!

Memory is a thing we forget with.

Mental Floss prevents Moral Decay.

Method acting.. I'm vaguely aware of it. - Picard

Microbrain, growl for me, let me know you still care. Q

Military intelligence is a contradiction of terms.

Minds are like parachutes, they only work when open.

Miracle owes its origin to the negation of thought.

Misspelled?  Impossible.  My modem is error correcting.

Monday is the root of all evil!

Money Not Found: Abort, Retry, break out Quicken?

Money is the root of all wealth.

More like Woody Woodpecker with a perm!

Mr Worf! Do you intend to blast a hole in the viewscreen?

Mr Worf... Fire at Will.. >BZZZT< ... Hey, where'd Riker \SL

Mr. Scott, energize.  Hey! Where'd that pink bunny come f\SLM

Multitasking causes schizophrenia..

My Dog ate my REP Packet!!!

My Mother loves ME!  It's the computer she hates.

My dad hit me only once - with the Buick

My hat covers my head.... Just like hair used to!!

My haystack had no needle!

My mother is NEVER on time! - Worf

My other vehicle is a Galaxy Class Starship ...

My other vehicle is a galaxy class starship.

My reality check just bounced.

My systems are only programmed for one at a time. þ Data

My teeth aren't the sharpest in the world. þ Ro

NAVY: Never Again Volunteer Yourself

Name:³ºÞº³º³Û³ºÝ³ºÝ³³ Rank:Þº³ºÛ³ºÝ³ Serial No:³ºÞº³º³Û³

Never eat more than you can lift.

Never enough time, unless you're serving it.

Never park your hard disk in a tow-away zone.

Never test for an error you don't know how to handle.

New Mexico?  Sorry, we don't do ship to foreign countries

New strain of system-trashing virus : WINDOWS

Nietzche is pietzche, but Sartre is smartre.

Night of the living dead chipmunks

No person ever became wicked all at once.

No wanna work.  Wanna bang on keyboard.ÿ

No, I'm from Iowa. I only work in Outer Space.

No, Q, I meant a BUD light!

Noah!  Come quick!  There's water in the basement!

Nobody roots for Goliath.

Nonsense, no man I know can do it that way. þ O'Brien

Northern Exposure: Watch out for the frostbite!

Not a scrap. I was deliberately wasting your time, sir.

Not, I think, today, Commander. - Picard

Nothing is 100% certain, bug free or IBM compatible.

Nothing is so smiple that it can't get screwed up.

Notice how easily it detaches. þ Ro

Now that I've given up hope I feel much better...

Null modems were created when God got no handshake.

OK Scotty, NOW!  Detonate and energize!  I mean.......

OK, I'm weird! But I'm saving up to be eccentric.

OPERATOR ERROR: Nyah, Nyah, Nyah, Nyah, Nyah!

OPINION: Where "moderation" means "attack."

OS/2 2 ..Will it send DOS & Windows the way of CP/M ?????

OS/2 VirusScan - "Windows found: Remove it? (Y/y)"

OS/2...Opens up Windows, shuts up Gates.

Of course I'm running WindowsÛëÖøÂ NO CARRIER

Oh Tasha, See Me, Feel Me, Touch Me!

Oh no, not another learning experience!

Oh very clever Worf, eat any good books lately?

Oh, Picard, I will enjoy you morning, noon and night!

Oh, well... never mind!

Okay - right after this one we're BACK to the TOPIC!

Old age is better than the alternative.

On the other hand..you have five different fingers

Once you understand your computer it is obsolete

One Klingon Flea to another...Meet you on the next ridge.

One person's <grin> is another's <groan>.

One way to better your lot is to do a lot better...

Only in your dreams, Commander. þ Troi

Oops, time for Ponn Farr!

Our OS which art in CPU - UNIX be thy name .....

Our necessities are few but our wants are endless...

Outlaw junk mail, and save the trees!

Ow. I believe I have overexerted myself.- Data

Oxymorons... "military intelligence" and "tech support"!

PATH=harddrive;drawer;desktop;pocket;boxincloset;boxunder

Parallel processors share the task.

Pardon me, do you have any grey poop on?

Path = Wandering Considerably.

People can be very frightened of change.        Kirk STVI

People! Can't live with em, Can't live without em!

People! Can't live with em,Can't live without em

Peter Norton is the "Betty Crocker" of software!

Pets are not just for Christmas, but for a LIFETIME!!!!

Pets: pure love contained in soft packages.

Phasers don't kill people...Unless you set them too high

Picard to Lwaxana: "Not THAT kind of 'Engage'!"

Picard to bridge, where am I?

Plagarism prohibited.  Derive carefully.

Plasma is another matter.

Please Tell Me if you Don't Get This Message

Please recycle this tagline.  Once is not enough.

Please think when you drink....

Please, doctor, not while my wife is on board. þ O'Brien

Political Correctness is a Borg plot.

Pound forehead on keyboard to continue.

Power corrupts.  Absolute power is kind of neat.

Power corrupts.  Absolute power is kinda neat....

Prejudice is the reason of fools. Voltaire.

Press any key to continue or any other key to quit

Pro & con are opposites, what about progress & congress?

Proceed with Caution - Twisted Mind Under Construction!

Procrastination means never having to say you're sorry.

Program too small to fit into memory.

Proofread carefully to see if you any words out.

Prune Juice. A warriors drink!

Push any key. Then push the any other key.

Put it to the wall, Mr. LaForge. - Picard

Put your hard drive to your ear. Can you hear the C: ?

Qagh -- it's not just for breakfast anymore!

Quick! Close your mind!! Something might get in.

RAM = Rarely Adequate Memory

REAL programmers use undocumented DOS calls

RIP... This tagline had now been ripped off.....

Rainy days and automatic weapons get me down....

Read the docs. Wow, what a radical concept!

Real Trekkers work out at the He's Dead Gym.

Reality is for people who can't handle Star Trek.

Reduce Carbon Dioxide emmissions - STOP Breathing

Reduce brain fat.  Eat Moral Fiber.

Riker, AKA "Number One." A spy for the Borg?

Ronald Regan: Milli Vanilli of presidents.

Rule #167: niether a borrower nor a lender be. --Robin Le\SLM

S met ing's hap ening t  my k ybo rd . .

SEGA and Nintendo are combining, they call it Windows NT

STICK \'stik\ n. 1: A boomerang that doesn't work.

STRING space corrupt?  But I always use TAPE!

SYSTEM ERROR:  press F13 to continue...

Salvation is only a Beer Bottle away.......

Same to you and whatever you meant by that!

Sane?  Hell, if I was sane why would I be here?

Schizophrenia beats sysoping alone.

Scott me up, Beamie!

Scotty! Hurry, beam me u....*       NO CARRIER

Second star to the right and straight on till morning.

Sector Not Found (A)bort, (R)etry, (C)offee?

Security, confine Ensign @LN@ to the brig.

Security, get that floozy off my bridge. þ Picard

Send more tourists..... the last ones were delicious!

Set phasers on tickle!

Set phasers to extreme itching!

She canna take anneh more, Cap'n!

She sells C shells

Shh! Be vewy quiet, I'm hunting wuntime errors!

Shoot your program and put it out of its memory!

Shoplifters with the runs take Clepto Bismol

Show me a sane man.  I'll cure him for you.

Shut up, Spock!  We're rescuing you!  --McCoy

Shut up, kid.  -- Guinan

Silly Wabbit, QWKs are for kids!

Sir, I've been meaning to dicuss these feelings. þ Troi

Six megs, two monitors, and an attitude

Smash forehead on keyboard to continue...

Smile!  You're on Candid Modem!

Smile, but sharpen your knives.

Smile... people will wonder what you've been up to.

So many idiots... too few flame-throwers...

So many lawyers, so few bullets.

So, my brother is human after all. - Robert Picard

Society like air, is necessary but not complete for life.

Some Do, Some Don't, Some Will and Some Won't.

Some minds should be cultivated, others plowed under...­

Some people are, through no fault of their own, sane.

Somebody got up on the wrong side this morning. þ Riker

Somehow, I can't see myself doing it for money. þ Geordi

Sorry, I forgot all about the Amnesia Conference!

Sorry... my mind has a few bad sectors.

Southern DOS:  Y'all reckon? [yep/nope]

Southern DOS: Y'all Reckon? (Yep/Nope)

Spaghetti code means job security.

Spare time?  You're lookin' at it.

Speak softly and carry a two-handed sword.

Spice up your love life....kiss a Klingon today!

Split personality?  Who, us?

Stand down from battle stations, and Ensign change your p\SLMR

Standards are wonderful: so many from which to choose!

Star Trek XXVII - The Search for Shatner's Teeth.

Start slow and taper off.

Stay back! I have a modem and I know how to use it!!

Stealing a rhinoceros should not be attempted lightly.

Stick to your talent and the cows will be well tended.

Still going!  Nothing outlasts Data!  He keeps going and \SLMR

Stop tagline theft! Copyright your tagline (c)

Stop what you're doing and TAKE A SHOWER!!!

Stress- n. Doing a tight 180-dregree U-turn at Warp 9.5.

Support wildlife, throw a party.

Sure, Patrick, but will the Pontiac do warp nine?!

Sure, drinking kills brain cells, but only the weak ones.

Sure, we just route the main sensor through Data's cat.

TROI: I feel pain, GREAT pain! ... RIKER: Glad you liked \SL

TWO THINGS ARE UNIVERSAL. HYDROGEN AND STUPIDITY.

Tagline Lotto: ²²²²²²²²²²<- Scratch here for prize.

Tagline error.  Contact your systems programmer.

Tagline frequencies are Open....

Tagline theft is a compliment.

Tagline wanted. Apply within ====================>

Taglines  \'tag-l„inz \  The bumperstickers of BBS'ing.

Taglines are irrelevant. You will be assimilated into the\SLMR

Taglines...the electronic "bumper sticker"...

Take a bite out of crime .. Abolish the IRS!

Take no friends and leave no enemies.

Take two crows and caw me in the morning.

Tell me more about these "habits". þ Beverly

Thank you, God. Keep it up!!!

That was so fast, can you show me one more time? þ Troi

That's enough, Data!

That's the nuttiest idea you've had, Counselor. þ Geordi

The 486SX: Intel's test of your gullibility

The 486SX: Intel's test of your gullibility!

The Away Team went on a mission and all I got was this lo\SLMR\TAGLIN

The Borg are coming!  Quick!!  Try and look useless!!!

The Borg assimilated my race and all I got was this lousy\SLMR\TAG

The Counselor and I will be indisposed today. þ Riker

The Dead Shall Walk the Earth and Dine on Flesh

The Electric Chair Choice: Regular or Extra Crispy?

The USS Reagan -- "To boldly ... um ... I forget..."

The best defense is to stay out of range.

The buck doesn't even slow down here.

The current death rate?  One per person, of course.

The days of the digital watch are numbered

The evidence before the court is incontrovertible...

The fewer the facts, the stronger the opinion.

The future is like the present, only longer.

The future isn't what it used to be.

The heart is wiser than the intellect...

The hell with the prime directive, let's kill something.

The highest bidder catches the most politicians.

The immoratal words of Socrates -- "I drank what?"

The irony of life is that no one gets out alive

The irony of life is that no one gets out alive...

The moving cat sheds, and having shed, moves on...

The number you call from has been disconnected.

The occipital area of my head seems to have impacted...

The only thing shorter than a weekend is a vacation.

The past should be a springboard, not a hammock.

The pen is the tongue of the mind.

The price of purity is purists.

The road to success is under construction...

The surest way to be late is to have plenty of time.

The trick in overcoming temptation, is to play dead.

The ultimate Turn on.  When they shoot at you.. and miss!

The universe is laughing behind your back

The worst thing about censorship is ÛÛÛÛÛÛÛÛÛÛ.

Their are trhee things wrong here.

There are times when I long for a Klingon woman. þ Worf

There is a tiny plant here, murmuring "water, water".

There is intelligent life on Earth, but we are just visit\SLM

There is no gravity--The earth sucks!

There is one God, but which one is He?

There once was a [ ] from [ ] whose [ ] was

There's always 1 more SOB than you counted on

Thesaurus: ancient reptile with an excellent vocabulary.

These aren't my shorts -- they bend !

These things on my nose aren't just for show. þ Ro

They DO make 'em like they used to.

They're baaack!

Thin may be in, but fat's where it's at!

Things are not as bad as they seem - they're worse

Third of Five, six of one, half a dozen of the other

This Charlie Brown must have been a very wise man.

This game is exceedingly simple. þ Data

This guy has blown me off for the last time. þ Geordi

This information fills a much needed gap

This is a Ferengi Tagline.  You owe me 500 credits for re\SLMR\TAG

This is a Tagline mirror><rorrim enilgaT a si sihT

This is a hell of a time for a walk in the park. þ Geordi

This is our only tag line.

This isn't a holodeck, darling, this is real. þ O'Brien

This message cleared by Iraqi censors.

This message is $hareWare! To register, please send $20

This message is SHAREWARE!  To Register, send $5.

This message written by Dolphin Boy.

This message written by Sandy. A highly trained dolphin.

This message written by Zippy the Dolphin.

This meszage has bin spel chequed.

This never would've happened if I were captain. þ Riker

This sentence is a !!! premature punctuator

This space left blankish.

This tagline was reclaimed and is not yet stolen.

Those who can, do.  Those who can't, supervise!

Tick - Tock, Tick - Tock. Time is wasting away...

Time takes time.

Time travel gives me nosebleeds. - LaForge

Tis but a flesh wound...

To err is human, to forgive is against FidoNet policy.

To register this tagline, send $29 to ....

To shoot a mime, do you use a silencer?

Today is the tomorrow you worried about yesterday.

Transporter room, beam that tagline up immediately!

Transporting really is the safest way to travel.

Trek Classic -- Who Needs Another Generation?

Trek excuse #1: The Prime Directive clearly forbids it!

Tried to play my shoehorn... all I got was footnotes!

Trust in God, but backup your hard disk TODAY!!!

Truth is just another misconception.

Trying to think of a good tagline...

Two Wrongs Don't Make A Right, But Three Lefts Do.

Ultimate oxymoron:  "Cash Surplus"

Unable to load REALITY.SYS -- Invalid Parameter: /UTOPIA

Unable to locate TEAEARLGREY.HOT -- Enterprise halted!

Unix?  I can't even do ONE thing at once.

Used Iraqi rifles for sale: Dropped once, never fired...

User - a technical term used by computer pros. See idiot.

VCR's are a way to defeat time.....

Vamoose ya little varmint! - Data

Vuja De - The Feeling You've Never Been Here

Vulgarity: The conduct of others.

VŒçšî¨!¨  Wî d™¥'t g™t ¥™ tŒ¥kŒ¥g vŒçšî!!!

WARNING... drinking tap water may kill your thirst!

WOM - Write only memory

Walk through doors, don't crawl through Windows.

Warp 5 ... engage.  No, no, Mr. Data, more clutch!

Was Beehtoven's 1st movement done in the toilet or privy?

Was Tasha Yar the Enterprise's expert on Data entry?

Watch where you go... remember where you've been...

Watch where you go...remember where you've been...

We can't go back, and we can't stay here.  -- Picard

We come in peace.  Shoot to kill.

We do what we can but it's never enough.

We secretly replaced the dilithium with Folger's Crystals

We will get along fine as soon as you realize that I'm Go

We'll get along fine as soon as you realize that I'm God!

We're all bozos on this bus.

We're kick'n some ASCII now

We're lost, but we're making good time.

We've secretly replaced their dilithium with new Folger's\SLMR\TAGL

Well, I did a backup three weeks ago...

Well...my cray is in the shop.

Whaddya mean you don't STAPLE diskette labels on?

What Are You Looking For?  Nothing's Here!

What can you do at 3 AM?   Psssttt - got a modem??

What happened to my tagline?

What if there were no hypothetical situations?

What man doesn't like to stare once in a while? þ O'Brien

What part of "ten-line limit" don't you understand? þ

What would McGyver do now?

What's another word for "thesaurus"?

What's shorter then a weekend?  A Vacation.

Whatever happened to "Why is the sky blue?"

Whatever you do, you'll regret it.

When I want your opinion I'll give it to you!

When I was a kid, I was an imaginary playmate.

When all else fails, blame it on Dan.

When all else fails, blame it on the guy next to you!

When all else fails, read the docs.

When all else fails, take a nap!

When in danger,when in doubt,run in circles,yell & shout!

When in doubt, mumble.

When it comes to humility, I'm the very BEST there is!

When you discover you are dead, avoid driving a car.

Where are we going?... and why am I in this handbasket?

Where is the tagline supposed to go???

Where quality is just a word we like to use.

Where there's a will, there's an Inheritance Tax.

Where you stand depends on where you sit.

Who can say what's around the corner?

Who needs a house out in Hackensack?

Who the Dickens wrote "Oliver Twist", anyway?

Why USA fails? Radio Shack=USA's Technology Store!!

Why are apartments so close together?

Why are you wasting your time reading taglines?

Why is "easy listening" so hard to listen to?

Will Windows 3.1 come with a Hard Drive?

Windows 3.0: from the people that brought you EDLIN

Windows 3.1 coming to the rescue! Wait for FedEx!!!!!!!

Windows 3.1: from the people that brought you EDLIN!!

Windows 3.1: the best $99 solitare game I've ever seen!

Windows is to OS/2 as Etch-A-Scetch is to Art.

Windows isn't a virus -- viruses do something!

Windows may be slow, but at least it takes up a lot of

Windows may be slow, but at least it takes up a lot of ro

Windows: 80486 to 8088 conversion made painful...

Wit is educated insolence.

With all due respect, I'd like to go for a swim. þ Riker

With every wish there comes a curse.

With my Stealth Modem, you'll never see me coming!

XT at 8 Mhz. = 386 at 25 Mhz. + Windose !!!

XT/8 Mhz = 386/25 Mhz + Windose !!!

Yawn a more Roman way.

Yeah?  Well, tell that to her parents. þ Geordi

Yes my son, long ago mail was read 1 packet at a time.

Yes, I admit, *I* steal taglines!?!?!

Yes, I know I'm off-topic.  Thank you for your concern.

You are only young once, but you can be immature forever.

You are smart.  Can you make us go?

You can say you're (excrement) out of luck!

You cannot kill time without assaulting eternity.

You do not need a needle for ruptured pigs.

You gotta know when to hold 'em, know when to fold 'em.

You may be recognized soon.  Perhaps you should hide?

You should've heard me before you got here. þ Ro

You showed admirable restraint for one so small. þ Worf

You're never a loser until you quit trying.

You're on report, Ensign.  My quarters, 1900 hrs. þ Riker

You're one to tell me what I can and can't sense. þ Troi

You're twisted and sick; I like that in a person!

You're twisted, perverted, & sick. I like that

You're twisted, perverted, & sick. I like that!

Your cat's missing?  Have you checked my bumper?

Your statement fully describes the situation partially.

Zmodem has bigger bits, softer blocks, and tighter ASCII

[\] At 200' No One Can Hear You Scream...[\]

[dignified silence]

taH pagh taHbe' - Thought Master William epetai-Shakespea

tagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtag

thistaglineproducedbypkzip

"What?!? This isn't the Files section?!?"

My hard disk is full! Maybe I'll try this message section thing.

All I need is a Wave and a board to surf it on.

This BBS has achieved Air superiority.

What do you mean? You actually read this Tagline?!?

ARRRRRGGGHHH!!!! ... Tension breaker, had to be done.

My other computer is a VAX.

SENILE.COM found . . . Out Of Memory . . .    

I call things as I see them; If I didn't see them, I make them up!    

RAM = Rarely Adequate Memory    

(hic) BWave 2.10 (hic) BWave 2.10 * My computer is drunk ...

Backup not found: (A)bort (R)etry (P)anic    

I haven't lost my mind; it's backed up on tape somewhere!

Open mouth, insert foot, echo internationally.

The OFFICIAL tagline of the 1996 Olympics!

BEWARE - Tagline Thief in this echo

Tag line thievery ... On the next Geraldo!

"Could you continue your petty bickering? I find it most intriguing."

Reality-ometer:  [\........]  Hmmph!  Thought so...

Go straight to the docs.  Do not pass GO.  Do not collect $200!

Don't hit me, Mr. Moderator... I'll go back on topic... I swear!

Answers: $1, Short: $5, Correct: $25, dumb looks are still free.

Drop your carrier ... we have you surrounded!

I know a good tagline when I steal one.

This tagline is made just for @N@

"Mr. Worf, fire phasers at @FN@" ... Zzzzzap!

This tagline is SHAREWARE!  To register, send me $10

We now return to our regularly scheduled flame-throwing.

Do what you will with this tagline, just don't bother me about it!

A feature is a bug with seniority.

ebius tagline. This is a moebius tagline. This is a mo ...

Security, confine Ensign @LN@ to the brig.

Danger, @N@!  Off-topic messages!  Danger!

I'd rather ride the Wave than wallow in QWKsand!

Mary had a little RAM -- only about a MEG or so.

Back up my hard disk? I can't find the reverse switch!

"Yield to temptation, it may not pass your way again." - L. Long

Documentation - The worst part of programming.

"Transporter chief @LN@, beam the landing party to the bridge"

Not tonight, dear.  I have a modem.

"42? 7 and a half million years and all you can come up with is 42?!"

Two most common elements in the universe: Hydrogen & Stupidity.

"Don't mince words, @FN@ ... what do you *REALLY* think?"

He who dies with the most TAGLINES wins!

;

; Uncomment this one and insert your local phone company's name in there

;

;Line noise provided by Southern New England Telephone!

;

RAM DISK is NOT an installation procedure!

DOS never says "EXCELLENT command or filename"...

If it wasn't for C, we would be using BASI, PASAL and OBOL!

If at first you don't succeed, destroy all evidence that you tried.

Take my advice, I don't use it anyway.

But soft, what light through yonder tagline breaks?

Friends, Romans, countrymen, lend me your taglines!

A clean desk is a sign of a cluttered desk drawer.

"Milhouse, we live in the age of cooties!"  - Bart Simpson

MONEY TALKS ...   but all mine ever says is GOODBYE!

File not found. Should I fake it? (Y/N)

File not found, I'll load something *I* think is interesting.

New Mail not found.  Start whine-pout sequence? (Y/N)

...................... Group Photo

 But does Bo know double diamonds? 

 Age 'n Treachery Overcome Youth 'n Skill 

 We Know We Belong To The Land..OK 

 Chipmunks roasting on an open fire... 

  HELP.. I need a tagline. HELP.. Not just any tagline.

  Send lawyers, guns, and money!  

 What a long, strange trip it's been!                   

...Just a RIME without a reason.....

...Make...the Taglines go awaaaaaaaaaay....            

 I see how their eyes are gathered into one 

 There is more to reality than meets the eye           

    <- teenage mutant ninja tribbles                 

 This side up                                          

—¤Œ$×M‚¥Ñ Ÿ”ž Å Gœ‹¥ Â׳ˆVˆ$.ÕŒÀm at îÀeveü.           

                                     <- Cloaked Tribble

! Not on your life !                                     

"Apple" (c) Copyright 1767, Sir Isaac Newton.

"Bother," said Pooh, and deleted his message base.

"Boy, Data, you look great in a push-up bra!" - Riker

"Boy, that Data is slicker than cow snot!" - Guinan

"Call it a hunch." -- Quasimodo

"Captain, why not just give the Borg Windows 3.1?" - Worf

"Computer, delete WESLEY.EXE" - Entire Enterprise crew.

"Criminal Lawyer" is a redundancy.

"Data enjoys a lot of confusion, Jean-Luc." - Deanna

"Data! I thought you were dead!" "No, Sir. I rebooted."

"DOS=HIGH" Hmm, I knew it was on something...

"Energize!" said Picard and the pink bunny appeared...

"Excuse me, do you mind if I squish in here?" - Odo

"Fascinating," said Spock, watching Kirk's lousy acting.

"Fascinating."  Spock figures out the Energizer Bunny.

"Fire, Mr. Worf!"  [Worf picks up extinguisher]

"Format all 10?  Only 3 fit in the slot!

"Hand me that solar-powered flashlight..."

"Hello, World!" 17 Errors, 31 Warnings....

"Hex Dump" - Where Witches put used Curses?

"Hey, Worf! I hooked Data up to a Modem... wanna see?"

"I am a jelly doughnut." --John F. Kennedy

"I think not," said Descartes, and promptly disappeared.

"I'm all ears, hooman!" þ DaiMon Perot

"I'm not Bajoran.  Sisko punched me in the nose."  - Kira

"I'm the Doctor... gotta love me!" * Bashir

"Imagination is more important than knowledge" - Einstein

"Life," said Marvin. "Don't talk to me about life."

"MEOW"...SPLAT..."RUFF"...SPLAT...(Raining cats & dogs)

"Mr. Worf, scan that ship." "Aye Captain. 300 dpi?"

"My God, it's full of stores!" - 2001: A Shopping Odyssey

"My name is Crusher.  Where's Ensign Walnut?" - Beverly

"Really honey....just 1 more message."

"Swab the poop deck, raise the mizzenmast!" - Picard

"Toto, I don't think we're in DOS anymore..."

"What's 'e matter w' that thing?" - Scotty

"What's up, Doc?" - Ensign Bugs to Crusher

"Why stop now?  Just when I'm hating it." -Marvin

# of Vulcans needed to replace a bulb? Precisely 1.0000000

$$$ not found --  A)bort, R)efinance, D)eclare bankruptcy

&TheMenWhoHoldHighPlacesMustBeThe1stToStart..

(A)bort (F)ail (T)oss computer across room

(A)bort (R)etry (I)nfluence with large hammer

(A)bort (R)etry (S)ue

(A)bort (R)etry (T)ake an axe to it?

(A)bort (R)epent (I)gnorant?

(A)bort (R)etry (F)ail, (G)rab_Hammer

(A)bort (R)etry (G)et The Sledge Hammer

(A)bort (R)etry (I)gnore, (K)ick system?

(A)bort (R)etry (I)gnore, (O)verthrow System?

(A)bort (R)etry (I)gnore, (S)orry I Asked!

(A)bort (R)etry (K)ill innocent bystanders

(A)bort (R)etry (P)anic

(A)bort (R)etry (P)retend this never happened . . .

(A)bort (R)etry (S)ell it

(A)bort (R)etry (S)mack the @#$&*~ thing!

(A)bort (R)etry (S)mack the friggin thing

(D)inner not ready:  (A)bort (R)etry (P)izza

(I)gnore (R)etry (A)bort (M)eltdown

*    <- Tribble       ù    <- Tribble After a Close Shave

*    <- Tribble   #    <- Tribble After Borg Assimilation

* * *   (Tribbles)    é é é  (Tribbles after Biology lab)

* * * <- Tribbles     <- Tribbles on drugs

* * * <- Tribbles     <- teenage mutant ninja tribbles

* * * <- Tribbles        <- Cloaked tribbles

* * * <- TRIBBLES    o o o  <- TRIBBLES after hair cut!

* * * <- Tribbles   ê ê ê <- Tribbles wearing condoms

* * * <- Tribbles  ®*¯   <- Sergeant tribble

* * * <- Tribbles     <- Hari Krishna tribbles

* * * <- Tribbles  *ý *ý *ý <- Squared tribbles

* * * <- Tribbles  . . . <- Tribbles after a haircut

* * * <- Tribbles  ‘ ‘ ‘ <- after the wash cycle

* * * <- Tribbles  “ “ “ <- after hairclub visit

* * * <- Tribbles  o o o <- Bald tribbles

* * * <- Tribbles  oð oð oð <- Tribbles on a windy day

* * * <- Tribbles  _ _ _ <- after fight with Godzilla

* * * <- Tribbles  ~*~ ~*~ ~*~ <- Tribbles in heaven

* * * <- Tribbles  ³ ³ ³ <- after being stuck in elevator

* * * <- Tribbles  ë ë ë <- Hari Krishna tribbles

* * * <- Tribbles  í í í <- Tribbles with hula hoops

* * * <- Tribbles  ð ð ð <- dissected tribbles

* * * <- Tribbles  ù ù ù <- Tribbles after a haircut

* . . . . .                   <- Tribble Mother and Young

* <-- Tribble     è <-- Tribble Sandwich

*****************Dang*Tribbles******************

***ďÄ***  <Ä Heavy-Weight Tribble Lifter.

*/ \*       <-Tribbles having a swordfight

*// *// *//   <- Tribbles Going Skiing

*8 *8 *8  <--- Tribbles and mamas out for a stroll.

*>  -    |  <- Tribble Archery

*^ *^                                 <- Tribbles Praying

*}- Tribble Olympics: Archery

*¿  <--  Grandpa Tribble with his cane

*Ù *Ù    <- Tribbles Snorkelling

...and sometimes the bear eats you.

...but there are no old, bold pilots.

...no thanks, I'm already having one.

...would you like me to sing you a song?

...ywercs lla og tsuj sgniht semitemoS

113 grams, 10 milliliters ... He's lead, Jim.

186,282.3959 mi/sec: Not just a good idea, it's the LAW.

640K ought to be enough for anybody." - Bill Gates, 1981

7 Days without pizza makes one weak...

9 out of 10 men who tried Camels prefer women.

9.8 m/sý: Not just a good idea; it's the LAW!

:) :D :O :( :[ ;) 8) B) :> |I :P =) :S :B :] :\

<----- The information went data way ----->

A clean desk is a sign of a cluttered desk drawer.

A cult is a religion without political power.

A filthy Data is Gunked, hosed down and sand blasted.

A fool and his money are my two favorite people.

A fool and his money are SYSOP material.

A Mogwai is simply a highly evolved Tribble.

A nod's as good as a wink to a blind bat!

A procrastinator's work is never done.

A surprised Data is propositioned by the E's Computer.

A Tale of Two Zities -Dickens's cookbook

A tribble a day keeps the Klingons well fed.

A truly lazy person is never bored.

A victim of a prank, Geordi puts a banana over his eyes

A:  I don't know  and I don't care.

ABORT: Drivel filter is compromised!

Actually it is an interplanetary greeting.

Advisor: The guy who told you how to screw up

After a long bath Worf sees the fleas as his true friends

After much thought Picard assumes the bowling ball phase.

Air conditioned environment - Do not open Windows.

Albatross, get your albatross ....

All government is theft, some just steal less.

All right, set phasers to deep fat fry!

All right, who's been cooking hot dogs in the Warp Drive?

All stressed out, and no one to choke.

All true wisdom is found in taglines.

Always remember to pillage BEFORE you burn.

Anal retentive people don't give a crap.

Anatomically Correct beats Policically Correct ANY DAY!

And Adam asked "What's a Headache?"

And God said: E = «mvý - Zeý/r, and there was light.

And I thought *I* had problems!

And now a word from our sponsor...

And now... The Larch.

And you thought CHAOS ment rush-hour traffic!

Another day, another shaving accident.

Answers: $1.  Correct answers: $5.  Dumb looks: Free!

Anything that can go wr ... # ^% Bus Error -- Core

Apathy Error: Don't bother striking any key.

Are Cheerios really donut seeds?

Are you a Klingon, or is that a turtle on your head.

Are you out of my mind?

ARRRRRRRRRRRRRRRRRGGGGGGGGGGGGGHHHHHHHHHHHHH!

ASCII stupid question, get stupid ANSI

Aural sex produces eargasms.

AUTOEXEC.BAT = Lee Iacocca as a vampire.

Awwww its just a Harmless little Bunny!

Backup not found: (A)bort (R)etry (P)anic

Backup not found: (A)bort (R)etry (S)ell Computer

Bad command or file name. Go sit in corner.

Bad Command or Filename.  Or maybe you screwed up.

Barnum was wrong....it's more like every 30 seconds!

Basic Airline Flying: Keep the pointy end forward

Be wewy wewy quiet...I'm hunting Womulins!!

Beam me up Scotty. This isn't the men's room.

Beam me up, there's no intelligent life here!

Behaviorist psychology -- pulling habits out of rats.

Being one man too many, Ensign Extra is booted off the E.

Best file compression around!  "DEL *.*" - 100% comp.

Bill Gates made $6.3 Billion selling us MS-DOS?

Bird lives.

Blood is thicker than water, and much tastier.

Borg Mail Reader v2.1a  Tagline theft is futile.

Borg Mail Reader v2.1a  Taglines are irrelevent.

Borger King: We do it our way. Yours is irrelevant.

Borger King: Have it our way. Your way is irrelevant.

Boss spelled backwards is "double-SOB"

Bow down to Rick Wakeman!

Brain Disengaged; Call Back Tomorrow.

BRAIN.COM file closed. (A)rgue (R)etry (F)orget It

BREAKFAST.COM Halted...Cereal Port Not Responding.

Breaking Windows isn't just for kids anymore...

Breath Deep, The Gathering Gloom...

Bring home the bacon?  HECK!  I Brought the PIG!

BUFFERS=7 FILES=5, 2nd Down, 4th quarter, 5 yards to go!

But I thought YOU did the backups...

But of course, it *is* only my opinion.

But soft, what bird through yonder window breaks?

But Windows bashing is my job...

C:\BELFRY is where I keep my .BAT files ^^^oo^^^

C:\DAMSEL.EXE crosslinked w/DISTRESS.COM--RESCUE?(y/n)

C:\DOS   C:\DOS\RUN    RUN\DOS\RUN

C:\DOS  C:\DOS\RUN  C:\DOS\CRASH

C:\DOS  C:\DOS\RUN  C:\DOS\RUN\WINDOWS  C:\DOS\RUN\SLOW

C:\DOS C:\DOS\RUN C:\DOS\RUN\AMUCK

Canadian DOS prompt: EH?\>

Canadian DOS: "Yer sure, eh?" [y/n]

Captain ... one .. harmless ... little ... Tribble?

Captain please, not in front of the Klingons.

Captain!  The UARTs kenna' take these speeds!

Captain! Someone has snorted all the dilithium crystals.

Captain, I need to kill someone. þ Worf

Captain, please.  Not in front of the Klingons.

Captain, we have engaged dataschlurp mode!

Carpe diem, quam minimum credula postero!   Horace (8 BC)

Caution: This stuff is addictive...

Click..Click..Click..Damn!  Out of taglines!

COFFEE.COM not found: (A)bort, (R)eheat, (S)nooze

Cogito ergo cogito !

Coming Soon!!  Mouse Support for Edlin!!!!

Coming Soon. Mouse Support for Turbo Edlin!

Coming Soon... Turbo Edlin!

Coming soon: Netware for Nintendo

Computer, microwave decks 5-10 until piping hot.  BEEP!

Computers ARE the future. Oh the future looks grim!

Confidence is telling someone how to use his Twit Filter.

Confuse people: start making sense.

Conservatism is the worship of dead revolutions.

Contains less than 2% U.S. RDA for this echo

Control-Alt-Delete thyself

Copy from another: plagiarism. Copy from many: research.

Could be an ever-opening flower.

Crime does not pay... as well as politics.

Crime wouldn't pay if the Government ran it!

Critical error: (S)hout, (S)mash, (B)uy a mac.

Curiosity didn't kill the cat. I got 'im with the mower!

CURSOR: What you become when your system crashes.

Cut life support to all quarters with children * Picard

Daddy, what does "FORMATTING DRIVE C:....." mean ?

Dammit, Jim, I'm a floor wax, not a dessert topping!

Damn It Jim!!  I'm a Doctor not a Tagline writer!!!!!

Darn! Out of tribble tags!

Darn! STILL out of tribble tags!

Data becomes vilently ill with a computer virus.

DATA COMPRESSION: What You Get When You Squish An Android

Data convinces the Coke machine that Pepsi is better.

Data enjoys a smoke after interfacing with the Computer.

Data- "It IS the Stay Puft Marshmallow Man, Captain!"

Deanna tries to read my mind and sees taglines.

Deanna tries to read Picard's mind and sees Pontiac.

Death: The unfortunate side effect of attacking a cop.

Decay, inherent in all component things. Buddha-last wrds

DESQview: Better windows

DESQview: Faster than a Cray (running Windows)

DEVICEHIGH:  Your device driver on drugs.

Diarrhea is hereditary.    It runs in your jeans.

Did Qmodem originate in the Q continuum?

Difference between a virus & windows? Viruses never fail.

Direct from the Ministry of Silly Walks.

Do I smoke after sex?  I never looked.

Do it now! There might be a law against it tomorrow.

Do not expose this tagline to direct sunlight.

Do televangelists do more than lay people?

Do you feel Lucky, punk???

Do you know JESUS? If so, tell him he owes me $2.

Does bouncing count?

Does the E's Computer have enough RAM to run Windows?

Dogs come when you call. Cats have answering machines.

Don't be a schmuck... BE A SCHMUCK!

Don't hate yourself in the morning --- sleep until noon!

Don't kill the whale.

Don't let a fool kiss you or a kiss fool you.

Don't Panic!!!

Don't play "stupid" with me - I'm better at it.

DON'T STEAL - The government hates competition.

Don't surround yourself with yourself.

Don't Think!!!!! SCHEME !!!!!

Don't torture yourself...that's my job.

DOS is todays CP/M - Windows is tomorrows CP/M!

DOS means never having to live hand-to-mouse.

DOS never says "Excellent command or filename..."

DOS:  Tells a computer what to do with itself!

DOS=HIGH? I knew it was on something...

Double your drive space! Delete Windows!

Drive A: not responding.. .Formating C: instead

Dust-balls - The cheap man's tribble.

Earth- Mostly Harmless (HHGTG 2nd ed.)

Eat triticale: 3.56 quadrillion tribbles can't be wrong!

Editing is a rewording activity.

Electric chairs are period furniture: they end a sentence

Elegant Frankfurter - A haute dog

Elvis is alive and doing my laundry.

Elvis is dead and I don't feel so good myself.

English is wonderful, when used correctly.

Ensgin Expendable, step on that rock! - Kirk

Ensign Singer... Make it sew.

Ensign Walnut approaches Dr. Crusher with caution.

Ensign, engage datasuck mode!

Entropy ain't what it used to be.

Error #1511: Brain Offline

Error 005: Windows loading. Come back tomorrow.

Error 96:  Dead mouse in hard drive.

Error : (A)bort (R)etry (S)ell it

Error finding REALITY.SYS  -  Universe halted.

Error in REALITY.SYS.  Run BIGBANG.EXE (Y/N)

Error reading FAT table.  Try SKINNY one?  (Y/N)

ERROR:  CPU not found

ERROR: REALITY.SYS Corrupted -- Universe unrecoverable

Even the dullest candle burns brighter in the dark.

Ever have one of those millennia?

Ever notice how fast Windows runs? Neither did I...

Every absurdity has a champion to defend it.

Everyone hates me because I'm paranoid.

Everyone is entitled to my opinion.

Excited, Spock opens a box full of pointy ear tips.

Eyeing little girls with bad intent, heh.

Fatal mouse error. (B)ury or (R)eplace?

File not found, but if you'll hum a few bars...

File not found. Should I fake it? (Y/N)

File not found. Should I fake it? (Y/N)

File Not Found. Loading something that looks similar.

File Not Found: (A)bort, (R)etry, (F)ake It?

Files not found:  Delete user instead? (Y/y)?

First Shalt thou pull out the Holy Pin!

Friends don't let friends use Windoze.

Friends don't let friends use XMODEM!

Frostbite Falls Minnesota, home of Watsa Matta U.

Gee Wiz, I didn't know DOS is that stupid!

Gee, I wonder what this key does.

General Failure reading drive A:  Please remove your fist.

Give it to Riker- he'll eat anything!

GIVE: Support the helpless victims of computer error.

Glory is fleeting, but obscurity is forever...

Go ahead, back up to the RAM disk.  I dare you!

GOLFER--Yells "Fore!", Takes Five, Writes Down Three.

Good night, Mrs. Calabash, wherever you are.

Graduate of the Darth Vader School of Personnel Management.

Great green gobs of greasy grimy gopher guts!

Guts: putting the name "SYSOP" in your twit filter.

HA! I kill me!

Happiness is a warm modem.

Hat?  What hat?  That's a helipad for munchkins. - Guinan

Have time to waste?  Get Microsoft Windows 3.1!

Have you crashed your Windows today?

Have you thanked your SysOp today?

HD failure: (A)bort (R)etry (N)egotiate (C)ry

He does the work of three men: Larry, Moe and Curly.

He is almost a statesman.  He lies well.

He who dies with the most toys is still dead.

He who laughs last probably doesn't understand the joke.

He who smiles in a crisis has found someone to blame.

He who throws mud loses ground.

He's ALIVE, Jim. Where did I go wrong?

He's dead Jim. Grab his tricorder. I'll get his watch!

He's DEAD, Jim! Go to Sick Bay and get the Maggot Master!

He's DEAD, Jim. Get his ears. - Spock

He's dead, Jim. Kick him if you don't believe me.

He's DEAD, Jim. Tell the Klingons that dinner is served.

He's DEAD, Jim. You get his teeth. - "Bones" McCoy, DDS

Hell hath no fury like the lawyer of a woman scorned.

Hello.. Incontinence Hotline.. Can you hold?

Help! My computer is holding me prisoner...

Help--I'm being held captive by my modem!  

Hey Rocky, watch me pull a tribble out of my hat!

Hi Ho, Hi Ho, it's Hand Grenades I throw!

High thoughts must have high language.       Aristophanes

Hold on- wait, maybe the answer's looking for you.

How can you be deaf with ears like that? -McCoy

How do I set my phaser to tickle?

How do you make Windows faster? Throw it harder.

How to defend yourself against a Banana.

I *almost* stole a tagline! I'm so ashamed!

I am a man: nothing human is alien to me.        Terrence

I am become Death, the Destroyer of worlds  Oppenheimer

I am immortal, at least till I die.

I am looking for an honest man.         Diogenes (325 BC)

I am Popeye of Borg. Prepare to be askimilgrated.

I call a fig a fig, a spade a spade.  Menander (292 BC)  

I can't tell if I'm a kingpin or a pauper!

I can't use Windows.  My cat ate my mouse.

I could be chasing an untamed ornithoid without cause.

I DON'T EAT ANYTHING WITH A FACE!

I don't have any taglines to give you.  Go away.

I don't just tempt fate - I give it the finger.

I don't kill my enemies: I slime them! þ Odo

I don't steal taglines, I replicate them.

I don't want to be a cynic, but it's hard...

I drank what?!? þ Socrates

I fear Greeks even when they bring gifts.  Virgil (19 BC)

I Feel Better Now.

I got lost in thought. It was an unfamiliar territory.

I had a life once... but now I have a modem.

I HATE it when it does that!

I have a firm grip on reality. Now I can strangle it.

I have found power in the mysteries of thought. Euripides

I have to stop now.  My fingers are getting hoarse.

I is knot dain bramaged!!!

I know and I know you know I know.

I know on which side my bread is buttered.   John Heywood

I like kids, but I don't think I could eat a whole one.

I need some new taglines. This one is getting old.

I need Windows like a haemophiliac needs heart surgery!

I played poker w/ tarot cards-got a flush & 5 people died

I saw Elvis.  He sat between me and Bigfoot on the UFO.

I shave with Occam's Razor.

I smell a rat.  Did you bake it or fry it?

I survived torture.  I'm ready to date Lwaxana. - Picard

I think he's a couple bushels shy of a full crop

I think he's a couple keys short of a concert piano.

I think he's a couple of cans short of a six-pack.

I think he's a couple of ticks past the noon whistle.

I think he's a couple sharps short of B Major.

I think he's a few bars short of a finished symphony.

I think he's a few bricks short of a whole wall.

I think he's a few bytes short of a checksum.

I think he's a few channels short of Basic Cable

I think he's a few croutons short of a garden salad.

I think he's a few pipes short of a church organ.

I think he's a few strings short of a violin section.

I think he's one taco short of a combination platter

I think he's playing his oboe with just one reed.

I think he's playing solitaire with a pinochle deck.

I think he's playing the lead violin part on a viola.

I think he's playing the old five-string guitar.

I think I think, therefore I think I am.  I think.

I think, therefore I am... dangerous, that is...

I think, therefore I'm overqualified !!!

I use Windows... on my car, on my house, on my...

I was sane once... didn't like it.

I was the next door kid's imaginary friend.

I went mad once. Did me a world of good.

I wish I was a Klingon.  I want a lumpy head.

I wish life had a scroll-back buffer.

I won't use Windows, I won't use Windows, I won't...

I would like to buy a fish liscence, please.

I'll panic if I bloody well want to!

I'm a analog man in a digital world.

I'm a brain in a vat. Are you one too?

I'm a consultant because I'd rather be self-unemployed.

I'm a figment of your imagination.

I'm a Lumberjack and I'm OK!

I'm a workaholic who resisted a rest.

I'm as confused as a baby at a topless bar!

I'm Bugs Bunny of Borg.  What's up Collective?

I'm dangerous when I know what I'm doing.

I'm fascinated by the way memory diffuses fact.

I'm firm. You're obstinate. He's a pigheaded fool.

I'm flexible... just don't change anything.

I'm going to k-k-k-k-k-k-kill you K-k-k-k-k-k-ken!

I'm gonna plead insanity, what about you?

I'm in search of myself.  Have you seen me anywhere?

I'm just a peripheral visionary.

I'm just here for moral support. Ignore the gun.

I'm lost, but I'm still making pretty good time!

I'm mad at you because you were someone else.

I'm mooning you now, you just can't see me.

I'm more humble than you are!

I'm much too young to feel this damned old

I'm neither for, nor against apathy

I'm not a complete idiot - several parts are missing.

I'm not a crook; I'm "ethically challenged."

I'm not a minority. I'm an outnumbered majority!

I'm not a real sysop, I just play one on TV.

I'm not a witch doctor-- I'm only a folk medic.

I'm not an actor, but I play one on TV.

I'm not arrogant, I'm RIGHT!

I'm not confused, I'm just well-mixed.

I'm not dead yet! I think I'll go for a walk.

I'm not dead, I'm metabolically challenged.

I'm not lost, I'm "locationally challenged."

I'm not lost... I'm "locationally challenged".

I'm not nearly as think as you confused I am.

I'm not opinionated, I'm just always right!

I'm not paranoid! Which of my enemies told you that?

I'm not tense, just terribly A*L*E*R*T.

I'm only here for the salad bar.

I'm only paranoid because everyone's against me.

I'm out of bed and dressed.  What more do you want?

I'm practicing assertiveness.  Do you think that's okay?

I'm really sorry about always saying I'm really sorry.

I'm so broke I can't even pay attention

I'm solidly behind whichever side eventually wins.

I'm sorry, Dave. I can't do that. I'm all out of Taglines

I'm sorry. I'm afraid I've caught poetry.

I'm spending a year dead for tax purposes.

I'm the leader, which way did they go?

I'm usually awake near the end of the day.

I'm warning you! One step closer and I'll drop carrier!

I'm working on my 2nd $million...  Gave up on the 1st.

I've been scheduled for a karma transplant.

I've got a Mickey Mouse PC with a Goofy operating system.

IBM: When you care enough to spend the very most.

If "R" is Reverse, how come "D" is FORWARD?

If a program is useful, it must be changed.

If a tree fell on a florist,would he make a sound?

If all else fails, read the directions!

If all goes well, you've overlooked something!

If all is not lost, then where is it?

If all the world's a stage, I sure got lousy seats.

If an experiment works, something has gone wrong.

If at first you don't succeed, call it Ver 1.0.

If at first you don't succeed, change the rules!

If at first you don't succeed, cry.

If at first you don't succeed, fake it!!

If at first you don't succeed, forget it.

If at first you don't succeed, join the club.

If at first you don't succeed, lower your standards.

If at first you don't succeed, work for Microsoft.

If at first you don't suceed, you're about normal.

If Clinton is the answer, the question must be stupid.

If Corn Oil Is Made From Corn, What's Baby Oil Made From?

If flies couldn't fly, would they be called walks?

If guns are outlawed, can we use swords?

If I buy the steel wool, can you knit me a BMW?

If I follow you home, will you keep me?

If I save the whales, where do I keep them?

If I save time, when do I get it back ?

If I want your opinion I'll beat it out of you!

If ignorance is bliss, why aren't more people happy?

If it ain't broke, hit it harder.

If it ain't broke, wait a day or two!!

If it ain't one thing, it's two or three...

If it jams, force it. If it breaks, it needed replacing.

If it was easy, it wouldn't be any fun.

If it works, I didn't do it.

If it works, rip it apart and find out why!

If it works, something went wrong.

If it's not Scottish IT'S CRRAAAPPP!!!!!!!!!!!!!!!!!!!!!!

If it's obvious, it's obviously wrong.

If it's tourist season, where do I get a license?

If it's working OK, then something's GOTTA be wrong!

If life is but a dream please wake me up.

If love is blind, lingerie makes great braille.

If love is blind, why is lingerie so popular?

If only Einstein had a 486DX-33....

If plugging it in doesn't help, turn it on.

If puns are outlawed, only outlaws will have puns.

If rich, eat when you please. If poor, eat when you can. 

If speed scares you, buy Windows 3.1!

If the shoe fits, its ugly.

If we left the bones out it wouldn't be crunchy!

If Windows sucked it would be good for something.

If you believe in telekinesis, raise my hand.

If you can't be famous, try infamous.

If you can't elucidate, obfuscate.

If you can't laugh at yourself, I'll laugh at you.

If you don't think women are explosive, drop one!!

If you hear an Onion ring, please answer it!

If you really want to know, you won't ask me.

If you redo a batch file, is it a son of a batch?

If you save the world too often, it begins to expect it.

If you smoke after sex, you're doing it too fast.

If you throw a cat out the car window, is it kitty litter?

If you wake up Sleepy & Grumpy, you must be Snow White.

If you're trying to drive me crazy, you're too late!

If you've seen one nuclear war, you've seen 'em all.

Ignorance is Temporary ... STUPID is Forever!

Illiterate?  Write for FREE HELP!

In a fit of confusion, Spock uses Scotty as toilet tissue

In adversity remember to keep an even mind. Horace (8 BC)

Include this in your CONFIG.SYS File: BUGS=OFF

Iraqi rifle for sale. Never fired. Dropped once.

Is it weird in here, or is it just me?

Is sex in a cornfield "Porn on the cob"?

Is there life before coffee?

It doesn't work, but I'm working on it.

It is better to copulate than never.

It is far safer to be feared than loved.      Machiavelli

It makes a difference whose ox is gored.    Martin Luther

It takes a wise man to recognize a wise man.   Xenophanes

It's been lovely, but I have to scream now.

It's Ensign Pillsbury! He's BREAD, Jim!

It's getting better all the time.

It's never too late to have a happy childhood.

It's the Ugliness Men Mr. Horrible!

It's time for them to go.

It's too bad ignorance isn't painful.

Its GOOD to be the King! 

Its my tagline! I stole it first.

Its not a stolen tagline, it's just "previously viewed"

Jean-Luc Picard and Mister Clean:  Separated at birth?

Jesus saves... but Lindros scores on the rebound!

Jim watches in amazement as Spock's ears sprout broccoli.

Just when I make ends meet, someone moves one end.

Keyboard error or no keyboard, F1 to continue

Keyboard is unattached.  Press F10 to continue

Keyboard locked..Press F1 to continue

Keyboard not found, think "F1" to continue.

Keyboard: Used for entering errors into a system.

Kill the wabbit!!!  Kill the wabbit!!!

Know a good chiropractor? My computer has a slipped disk.

Ladies & Gentlemen, Elvis has left the building.

Lady Macbeth to her dog: "Out, damned Spot!"

Law is order, and good law is good order.       Aristotle

Leave no stone unturned.               Euripides (431 BC)

Let each man exercise the art he knows.      Aristophanes

Liars when they speak the truth are not believedAristotle

Life is one long struggle in the dark.  Lucretius (55 BC)

Life without learning is death. þ Cicero

Life would be easier if I had the source code.

Life's a joke, and we're the punchline.

Life... don't talk to me about life.

Light speed! Ridiculous speed! Ludicrous speed!

Lonely, Worf seeks a Dog/Turtle hybrid for companionship.

Love comes for you, and you follow.

Love is grand. Divorce is fifty grand.

Mac screen message: "Like, dude, something went wrong."

Macintosh: Computer with training wheels you can't remove

MAFIA DOS..Ey'What's A Matta You? Wanna Try Again (Y/n)?

Make friends with sysops; page them at 3:00 am.

Man is by nature a political animal.            Aristotle

Mandatory tagline not required for this message.

Many hands make light work.      John Heywood (1497-1580)

Master of images, songs shine a light on you.

May the Farce be with you!

May the Farce be with you!

Meaning of life: <deleted for lack of space>

Member, the Society for Creative Anachronism.

Member, the Society for Creative Anachronism.

MEMORY ERROR: Now what?

Men willingly believe what they wish.       Julius Caesar

Mental Floss prevents Moral Decay.

Mercifully free of the ravages of intelligence.

Millihelen: Amount of beauty required to launch one ship.

Minds, like parachutes, work only when open.

minimalist tagline

Misfortune shows those who are not friends.     Aristotle

Mister Worf, show these children the airlock. þ Picard

M”bius strippers have no rear end.

Mobius strippers never show you their back side.

Modems are proof that people enjoy torturing themsevles

Monday is the root of all evil!

More in the mind than the body this feeling.

Mountains come out of the sky and they stand there.

Move your vowels every day or you'll get consonated.

Mr Spock wears vulcanized rubbers.

MR. BILL . . .Ooooohhh Nooooooooooo¨{‘²ÆÅ NO CARRIER

Mr. Sco*t! G*t th*s* trib*les out*of m* ta*lin* n*w!!!

MS-DOS..MR DOS's sister -- DR DOS..MS DOS's Gynecologist

Multitask- Make twice the mistakes in « the time.

Mumbling to himself, Picard figures out the cheese grater

My appetite comes to me while eating. Michel de Montaigne

My AUTOEXEC.BAT is a vampire.

My computer's sick. I think my modem is a carrier.

My favorite mythical creature?  The honest politician.

My God! It's full of stars!

My God! They've gone to Plaid!

My Hovercraft is full of Eels.

My mama done tol' me...

My modem isn't slow- it's "baudily challenged!"

My mother was the tour guide for Guilt Trips...

My other computer is even slower.

My other tagline is a Porsche.

My other vehicle is a Romulan Warbird...

My train of thought is a Mag-Lev.

Nature does nothing uselessly.                  Aristotle

Never dare to judge until you've heard all.     Euripides

Never judge a book by its movie.

Never let a fool kiss you, or a kiss fool you.

Never take a beer to a job interview.

New book: 101 Ways to Brown-Nose to Success.

New campaign promise:  Babble fish for all

New mail not found. Start whine pout sequence? (Y/N)

Nightowls are _real_ people.

Nine times out of ten the statisticians are wrong.

Nixon's Principal: If 2 wrongs don't make a right, try 3.

No bathroom? Just boldly go where no man has gone before!

No falsehood lingers into old age.     Sophocles (406 BC)

No human thing is of serious importance.           Plato 

No man loves life like him that's growing old.  Sophocles

No!  No!  Nurse!!!  I said "prick his boil"!

Nobody knows the Tribbles I've seen.

None of you exist; my Sysop types all this in!

Nostalgia just ain't what it used to be ...

Not a real tagline, but an incredible soy substitute.

Not every soil can bear all things.        Virgil (19 BC)

Nothing can be created from nothing.    Lucretius (55 BC)

Nothing endures but change.           Heraclitus (480 BC)

Nothing is so simple that it can't get screwed up.

O.K to coninue??  <yes> <no> <MAYBE?>

Of all animals, the boy is most unmanageable.      Plato 

Oh freddled gruntbuggly, thy nacturations are to me...

Oh sure!  But what's the speed of dark?

Oh, very good Worf.  Eat any good books lately?

On the other hand, you have different fingers.

Once again, Odo wins the Twister championship.

Once harm has been done, even a fool understands it/Homer

Once more unto the breach, dear friends  Henry V

One swallow does not make a summer.             Aristotle

Only one good: Knowledge. One evil: Ignorance.   Socrates

Open doors we find our way; we look, we see, we smile.

Open Mouth, Insert Foot, Chew Carefully

Open mouth, insert foot, echo internationally.

OPERATER ERROR.. (A)bort, (R)etry, (S)hoot...

Originality is the art of concealing your source...

Ouch! And I mean it.

Overcome by jealousy, Data dismembers the Energizer Bunny

oׯ»*á*½ÃÒç  <--- Tribbles living near Three Mile Island.

™ð  ™ð  ™ð <- Tribbles on a windy day

Pack up your Tribbles in your old kit bag.

Philosophy is a walk on the slippery rocks.

Piety requries us to honor truth above friends. Aristotle

Pizza: Nature's perfect food.

Please return stewardess to original upright position.

Please steal this tagline, and spread it around the world.

Pleasure is the start and end of living happily. Epicurus

Politically Incorrect -- and damn proud of it!

Politics: Poly (many) + Ticks (blood-sucking parasites)

Polluting New Jersey... like who's gonna notice?

Power corrupts, but we still need electricity.

Power corrupts. Absolute power is kinda neat.

Press all the keys at once to continue...

Press any key - EXCEPT THAT ONE!!!

Press any key to continue or any other key to quit

Psychiatry is the care of the id by the odd.

Psychoceramics:  The study of crackpots.

PumpDon'tWork'CauseTheVandalTookTheHandle

Putting on his coroner's cap, Data enjoys a rotten corpse

Rainy days and automatic weapons get me down.

RAM disk is *not* an installation procedure.

Real knowledge is to know the extent of one's ignorance. 

Reality is blinking again...call for repairs.

Reality is for people with no grasp of fantasy.

Relativism stinks- you can't call anyone a moron!

Religious error: (A)tone, (R)epent, (I)mmolate?

Rid yourself of doubt, or should you...

Riker to Enterprise.  Beam down Troi and a six-pack.

Riker's trombone backfires, creating a new universe.

Riker's trombone backfires, creating a tagline.

ROM wasn't built in a day.

Rome was not built in one day.   John Heywood (1497-1580)

Ruling a country is like cooking a small fish.    Lao-tzu

Russia has the Moscow Circus; WE have CONGRESS!

Sado-necro-beastiality is beating a dead horse.

SANITY.SYS corrupt. MIND lost.

Save the wales! Nuke Greenpeace instead!

Scott me up Beamie!

Scotty is smoking the dilithium crystals again, Jim

Scotty: What is it?  Data: It is... it is green.

Second star to the right & straight on till morning...

Seize the day, put no trust in the morrow!  Horace (8 BC)

Self-deceit is easy; what one wishes one believes is true

SENILE.COM found... Out Of Memory...

Sex on TV can't hurt you...unless you fall off.

Sexy: Uses feather.  Kinky: Uses entire chicken.

She was using the landscape to hide herself!

She's ALIVE, Jim!  Pass the Trojans!

Shell to DOS....Come in, DOS.....Do you Copy?

Shh! I have to use my incomplete, divided attention here!

Silly question!

Sincerity is the Way.             (Mencius, 372-289 B.C.)

Sir! Romulan warbird decloaki»®õ÷üÁ NO CARRIER

SLEEP: that fleeting moment just before the alarm.

Snorting wildly, Worf actually smells his own feet.

So what's the matter with MY taglines?

Spam for me, with a side of crunchy frog.

Spock at Xmas: A pencil sharpener for my ears! Thanx, Jim

Spock, quick, I smell tribbles!

Spock, you are such a putz!

Spock/Data 1996: The Logical Choice

STAND BACK! I don't know how big this gets!

STATUS QUO is Latin for "the mess we're in."

STAY ALERT!TRUST NO ONE!KEEP YOUR LASER HANDY!

Stay back!  I have a modem and I know how to use it!!!!

Stop smirking Number One.

Strangely, Data finds himself relating to heavy metal.

Stranger in a strange country.         Sophocles (406 BC)

STUPIDITY is NOT a HANDICAP!  Park elsewhere!

Success lies in achieving the top of the foodchain.

Support Mental Health. Or I'll kill you.

Support your local medical examiner: die strangely.

Syntax? Why not, they tax everything else

SYSOP: The guy laughing at your typing.

Sysoping: More fun than being beaten with a sledgehammer

T'greatest griefs are those we cause ourselves. Sophocles

Tagline explodes, destroys BBS. Film at 11!

Talk is cheap.  Using a modem gets expensive.

Talk sense to a fool and he calls you foolish.  Euripides

Ted Kennedy's Bumper Sticker: My other car is underwater.

Temporary suspension of disbelief is a wonderful thing.

Tennis is irrelevant. - Bjorn Borg

That Rabbit's got a vicious streak a mile wide!

That's not a tagline! It's Odo! þ Sisko

The basis of a democratic state is liberty.     Aristotle

The best way to accelerate Windows is at escape velocity.

The company of just and righteous men is best.  Euripides

The Computer is impressed with Data's hardware.

The cost of feathers has risen.  Now even down is up.

The die is cast.       (proverb quoted by Julius Caesar).

The END (and more than you wanted to know)

The end is near... but wait for the sequel!

The freedom of poetic license.             Cicero (43 BC)

The good have no need of an advocate.    Phocion (317 BC)

The great man is he who does not lose his child's-heart. 

The guy sure looks like plant food to me!

The Ides of March have come.                Julius Caesar

The Law is your friend..but watch out for the Lawyers.

The magic of Windoze: Turning your 486 into an XT.

The majority isn't silent- the government is deaf!

The moon is made of a green cheese. J.Heywood (1497-1580)

The more I know about WINDOWS, the more I like DesqView!

The no-mind not-thinks no-thoughts about no-things.

The only good Mac is a big Mac!

The Sun is at the center of the Universe.      Copernicus

The thoughtless are rarely wordless.

The UARTs can't take much more o' this Captain!

The unexamined life is not worth living.         Socrates

The World: A comedy for thinkers; a tragedy for feelers.

There are no teachers -- only students.

There are two sides to every question. Protagoras(410 BC)

There is no benefit in the gifts of a bad man.  Euripides

There is no fool like an old fool.  J.Heywood (1497-1580)

There is no happiness where there is no wisdom. Sophocles

There's more to BBSing than meets the modem.

There's nothing more demoralizing than money.   Sophocles

There's safety in numbers: F16, F11, B2, F15....

Thereisonlysomuchyoucansayusingjustfiftyletters.

They aren't evil...just stupid.

Thinking quickly Spock opens a can of peas with his ears.

This hitteth the nail on the head. J. Heywood (1597-1580)

THIS IS AN EX-PARROT!!!

This is Elvis. Any messages for me?

This product was cruelly tested on small, furry animals.

This Tag Line no verb.

Those whom God wishes to destroy, are first made mad.    

Time cancels young pain.               Euripides (431 BC)

Time eases all things.                 Sophocles (406 BC)

To be human without passion is to be dead.

To boldly go where no one has gone before.

To him who is in fear, everything rustles.      Sophocles

To teach is to learn þ Japanese Proverb

Too little sex makes you repeat yourself redundantly.

Toodleoo, go with God, and don't take any wooden nickels.

Took an hour to bury the cat. Damn thing kept moving.

Toto, I don't think we're in DOS anymore...

Trespassers will be shot; Survivors will be shot again!

Tribble math: * + * = ***********************************

Tribble math: * + Grain = ***********

Tribbles - $5.00 for all you can pile on top of you.

Tried to play my shoehorn... all I got were footnotes!

True Multitasking = 3 PCs and a chair with wheels!

Truth, like surgery, may hurt. But it cures.- Han Suyin

Two heads are better than one.   John Heywood (1497-1580)

Two may keep counsel, if two be away. Heywood (1497-1580)

Two most common elements in the universe: Hydrogen & Stupidity.

Two wrongs don't make a right, but three lefts do.

Typed on my Ultra Megger Wallet Whammer.

Unable to load REALITY.SYS; Invalid parameter: /UTOPIA

Under every stone lurks a politician.        Aristophanes

Users: Keep them dry and don't feed them after midnight.

Using PKZIP Version 2.04zzzzzzzzzzz

Virus scanner:       "Windows" found.  Remove? (Y)

Vote Republican, it's easier than thinking.

Vultures only fly with carrion luggage.

Waiter: Unemployed actor

WARNING: Do not attempt this at home.

Was Jimi Hendrix's modem a Purple Hayes?

Washing Windows is better than running them.

Waste not fresh tears over old griefs. Euripides (431 BC)

Watch it - you're trying my infinite patience.

Ways to skin a cat #27: Use an electric belt sander.

We are all driven into the same fold.       Horace (8 BC)

We are but dust and shadow.                 Horace (8 BC)

We are on a roll! Cavorting on the Butter!

We have engaged the Borg.  The wedding will be Friday.

We live, not as we wish to, but as we can. Menander 292bc

We look for things. Things that make us go.

We need more unemployed politicians.

We now return to our regularly scheduled flame-throwing.

We're off to see the wizard....

Wesley Crusher, please report to airlock 5!

Wesley's temper tantrum: "I want a new universe for Xmas"

What are you gonna do? Bleed on me?

What CAN you get a nudist for Christmas?

What do you mean you "formated" the cat?!?

What fools these mortals be.

What happens to the hole when the cheese is gone?

What is food to one, is to others bitter poison/Lucretius

What is the avg. air speed of an un-laden swallow?

What soon grows old?  Gratitude.                Aristotle

What you do not want done to you, do not do to others.   

What's all this talk about hellfire & Dalmations?

What's another word for "thesaurus?"

When asked "What is a friend," Zeno ans'd "Another I."   

When in doubt, mumble!

When puns are outlawed only outlaws will have puns.

When truth entails tremendous ruin, lies are pardoned.   

When you know, you know; when you don't know, admit it.  

When your computer has a virus, DON'T use chicken soup!

Where are we going?  And why are we in this handbasket?

While drunk, O'Brien builds a leprechaun transporter.

While there's life, there's hope.          Cicero (43 BC)

Whom the gods destroy, they first teach Windows...

Why are Chinese fortune cookies written in English?

Why are elves chaotic? Brownian motion.

Why are there no blue M&M's?

Why are there so many actors in this movie?

Why bother phoning a psychic?  Let them phone you!

Why buy shampoo when real poo is still free?

Why did Kamikaze pilots wear helmets?

Why do they call them briefings when they take SO LONG?

Why do those that pay the least complain the most?

Why don't sharks attack lawyers? Professional courtesy.

Why is "abbreviated" such a long word?

Why is it called "rush hour" if it's so damn slow?

Why is there a watermelon on the bandsaw?

Why yes, they are Bugle Boy beans.

Windows doesn't kill you, it's the glass when it crashes.

Windows Ice Cream: Hoggin DOS

WINDOWS MULTITASKS! (in a DesqView window)

Windows to 486/50 mhz cpu: Don't rush me, don't rush me...

Windows:  an 80486 to XT Conversion Kit.

Windows: A cute clown suit for DOS.

Windows: big, expensive, pretty virus.

Windows: The best $89 solitare game you can buy.

Wisdom outweighs any wealth.           Sophocles (406 BC)

Women: You can't live with them, pass the beer nuts- Norm

Wonderful music. My compliments to the clef.

Word is a shadow of deed.             Democritus (400 BC)

Worf becomes anrgy at the thought of brushing his teeth.

Worf hides for days knowing his bumps have gone flat.

Worf: "Shields failing!" Picard: "Give 'em more homework"

Work out your salvation w/diligence.  Buddha - last words

Wî [0Mî ­ï 䏀î. GVî –Ÿ ™šâ mM0 §© D‹î.

Yoooouuuuu'rreee Irrelevant!  Daffy Duck of Borg

You *must* be kidding!

You can lead a man to ponder; you cannot make him think!

You Cannot Escape!  Resistance Is Futile!

You cannot see the wood for the trees.       John Heywood

You cannot teach a crab to walk straight.    Aristophanes

You gotta know when to code 'em, know when to modem.

You know how to win a victory, but not how to use it.    

You mean, we have ANOTHER modem to feed?

You pathetic, puny, puking, putrid puddle of poodle piss!

You were a stranger to sorrow; thus fate has cursed you. 

You wouldn't happen to have anything less... ducky?

Your descendants shall gather your fruits.         Virgil

Your E-Mail has been returned due to insufficient voltage

Yours is no disgrace.

^“^                <- Viking Tribble

_     <- Tribble Meets Godzilla

_ _ _ <- Tribbles, after fighting with Godzilla

________ÚÚÚ_¢.•_¿¿¿________ this is me looking at you.

ÍÍ--------  <-- Tribble-kabob

å   <--  Baby Tribble with bottle

çh‹  ‹  ”šâ  m”ëîM  éï  ëâšgs - Any questions?

ë ë ë       <- Hare Krishna Tribbles

ë*éèå흠 Darn!  Only one throroughbred Tribble left!

î\/är SîäÚ¿ ¦ ßÛß/\gÞ_iÞßÝä Do ßÛß̹­S?



Comments

Popular posts from this blog

ASHTAR COMMAND

9600 modems

FAIRY TALES OF HANS CHRISTIAN ANDERSEN THE SWAN'S NEST by Hans Christian Andersen